gabR [2020-03-10 09:19:05]

transcription activator of gabT-gabD, repressor of gabR (MocR/ GabR family)

Locus: BSU_03890

Isoelectric point: 6.71

Molecular weight: 55.00 kDa

Protein length: 479 aa

Gene length: 1440 bp

Function: regulation of gamma-amino butyric acid utilization

Product: transcription regulator

Essential: no

Synonyms: ycnF

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of gamma-amino butyric acid
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 440,025 → 441,464

The protein

Catalyzed reaction/ biological activity

• transcription activation of the gabT-gabD operon in the presence of GABA and PLP, transcription repression of gabR PubMed

Protein family

• MocR/ GabR family PubMed
• class-I pyridoxal-phosphate-dependent aminotransferase family (according to UniProt)

Domains

• N-terminal DNA-binding helix-turn-helix motif (corresponding to domains of the GntR family) PubMed
• C-terminal domain is homologous to PLP-binding large domain of aminotransferases PubMed
• HTH gntR-type domain (aa 14-82) (according to UniProt)

Cofactors

• gamma-aminobutyric acid, PLP PubMed

Effectors of protein activity

• activation of gabT-gabD expression is triggered by gamma-amino butyrate and pyridoxalphosphate PubMed

Structure

• 4MGR (the apo-protein) PubMed
• 4N0B (the complex with PLP) PubMed

Expression and Regulation

Operons

• Genes: gabR
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GabR: negative autoregulation, PubMed, in GabR regulon

Biological materials

Mutant

• MGNA-C014 (ycnF::erm), available at the NBRP B. subtilis, Japan
• BKE03890 (ΔgabR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC, downstream forward: _UP4_AAAATCCCCGTTACAGGGGA
• BKK03890 (ΔgabR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC, downstream forward: _UP4_AAAATCCCCGTTACAGGGGA

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage

References

Loading